#METABOLOMICS WORKBENCH FendtLab_20251003_073824 DATATRACK_ID:6523 STUDY_ID:ST004267 ANALYSIS_ID:AN007103 PROJECT_ID:PR002694
VERSION             	1
CREATED_ON             	October 9, 2025, 12:41 pm
#PROJECT
PR:PROJECT_TITLE                 	Histone deacetylase SIRT6 regulates tryptophan catabolism and prevents
PR:PROJECT_TITLE                 	metabolite imbalance associated with neurodegeneration
PR:PROJECT_SUMMARY               	In the brain, tryptophan byproducts are involved in the biosynthesis of
PR:PROJECT_SUMMARY               	proteins, energy-rich molecules (e.g., NAD+), and neurotransmitters (serotonin
PR:PROJECT_SUMMARY               	and melatonin). Impaired tryptophan catabolism, seen in aging, neurodegeneration
PR:PROJECT_SUMMARY               	and psychiatric diseases affects mood, learning, and sleep; however, the reasons
PR:PROJECT_SUMMARY               	for those impairments in elder and these ailments remain unknown. Our results
PR:PROJECT_SUMMARY               	from cellular, Drosophila melanogaster, and mouse models indicate that SIRT6
PR:PROJECT_SUMMARY               	regulates tryptophan catabolism by balancing its usage. Mechanistically, SIRT6
PR:PROJECT_SUMMARY               	regulates tryptophan and sleep quality through changes in gene expression of key
PR:PROJECT_SUMMARY               	genes (e.g., TDO2, AANAT), which results in elevated concentration of neurotoxic
PR:PROJECT_SUMMARY               	metabolites from the kynurenic pathway at the expense of serotonin and melatonin
PR:PROJECT_SUMMARY               	production. Such neurotoxic metabolites can affect various processes in the
PR:PROJECT_SUMMARY               	brain. However, by redirecting tryptophan through TDO2 inhibition in our new
PR:PROJECT_SUMMARY               	SIRT6-KO D. melanogaster model, the impairments in neuromotor behavior and
PR:PROJECT_SUMMARY               	vacuolar formation - parameters of neurodegeneration - could be significantly
PR:PROJECT_SUMMARY               	reversed.
PR:INSTITUTE                     	VIB-KU Leuven Center for Cancer Biology
PR:LAST_NAME                     	Fernández-García
PR:FIRST_NAME                    	Juan
PR:ADDRESS                       	Campus Gasthuisberg, O&N4, Herestraat 49, box 912, 3000 Leuven, Belgium
PR:EMAIL                         	juan.fernandezgarcia@kuleuven.be
PR:PHONE                         	+32 16 37 32 61
#STUDY
ST:STUDY_TITLE                   	Histone deacetylase SIRT6 regulates tryptophan catabolism and prevents
ST:STUDY_TITLE                   	metabolite imbalance associated with neurodegeneration - Human cell lines
ST:STUDY_SUMMARY                 	In the brain, tryptophan byproducts are involved in the biosynthesis of
ST:STUDY_SUMMARY                 	proteins, energy-rich molecules (e.g., NAD+), and neurotransmitters (serotonin
ST:STUDY_SUMMARY                 	and melatonin). Impaired tryptophan catabolism, seen in aging, neurodegeneration
ST:STUDY_SUMMARY                 	and psychiatric diseases affects mood, learning, and sleep; however, the reasons
ST:STUDY_SUMMARY                 	for those impairments in elder and these ailments remain unknown. Our results
ST:STUDY_SUMMARY                 	from cellular models indicate that SIRT6 regulates tryptophan catabolism by
ST:STUDY_SUMMARY                 	balancing its usage. Mechanistically, SIRT6 regulates tryptophan through changes
ST:STUDY_SUMMARY                 	in gene expression of key genes (e.g., TDO2, AANAT), which results in elevated
ST:STUDY_SUMMARY                 	concentration of neurotoxic metabolites from the kynurenic pathway, with a
ST:STUDY_SUMMARY                 	concomitant decrease in serotonin and melatonin production.
ST:INSTITUTE                     	VIB-KU Leuven Center for Cancer Biology
ST:LAST_NAME                     	Fernández-García
ST:FIRST_NAME                    	Juan
ST:ADDRESS                       	Campus Gasthuisberg, O&N4, Herestraat 49, box 912, 3000 Leuven, Belgium
ST:EMAIL                         	juan.fernandezgarcia@kuleuven.be
ST:PHONE                         	+32 16 37 32 61
#SUBJECT
SU:SUBJECT_TYPE                  	Cultured cells
SU:SUBJECT_SPECIES               	Homo sapiens
SU:TAXONOMY_ID                   	9606
#SUBJECT_SAMPLE_FACTORS:         	SUBJECT(optional)[tab]SAMPLE[tab]FACTORS(NAME:VALUE pairs separated by |)[tab]Raw file names and additional sample data
SUBJECT_SAMPLE_FACTORS           	ARPE-19	ARPE19 C32-1	Sample source:ARPE-19 | Genotype:SIRT6 KO	RAW_FILE_NAME=ARPE19 C32-1.d
SUBJECT_SAMPLE_FACTORS           	ARPE-19	ARPE19 C32-2	Sample source:ARPE-19 | Genotype:SIRT6 KO	RAW_FILE_NAME=ARPE19 C32-2.d
SUBJECT_SAMPLE_FACTORS           	ARPE-19	ARPE19 C33-1	Sample source:ARPE-19 | Genotype:SIRT6 KO	RAW_FILE_NAME=ARPE19 C33-1.d
SUBJECT_SAMPLE_FACTORS           	ARPE-19	ARPE19 C33-2	Sample source:ARPE-19 | Genotype:SIRT6 KO	RAW_FILE_NAME=ARPE19 C33-2.d
SUBJECT_SAMPLE_FACTORS           	ARPE-19	ARPE19 CC2-1	Sample source:ARPE-19 | Genotype:control	RAW_FILE_NAME=ARPE19 CC2-1.d
SUBJECT_SAMPLE_FACTORS           	ARPE-19	ARPE19 CC2-2	Sample source:ARPE-19 | Genotype:control	RAW_FILE_NAME=ARPE19 CC2-2.d
SUBJECT_SAMPLE_FACTORS           	ARPE-19	ARPE19 CC3-1	Sample source:ARPE-19 | Genotype:control	RAW_FILE_NAME=ARPE19 CC3-1.d
SUBJECT_SAMPLE_FACTORS           	ARPE-19	ARPE19 CC3-2	Sample source:ARPE-19 | Genotype:control	RAW_FILE_NAME=ARPE19 CC3-2.d
SUBJECT_SAMPLE_FACTORS           	HeLa	Hela c32-1	Sample source:HeLa | Genotype:SIRT6 KO	RAW_FILE_NAME=Hela c32-1.d
SUBJECT_SAMPLE_FACTORS           	HeLa	Hela c32-2	Sample source:HeLa | Genotype:SIRT6 KO	RAW_FILE_NAME=Hela c32-2.d
SUBJECT_SAMPLE_FACTORS           	HeLa	Hela c33-1	Sample source:HeLa | Genotype:SIRT6 KO	RAW_FILE_NAME=Hela c33-1.d
SUBJECT_SAMPLE_FACTORS           	HeLa	Hela c33-2	Sample source:HeLa | Genotype:SIRT6 KO	RAW_FILE_NAME=Hela c33-2.d
SUBJECT_SAMPLE_FACTORS           	HeLa	Hela cc2-1	Sample source:HeLa | Genotype:control	RAW_FILE_NAME=Hela cc2-1.d
SUBJECT_SAMPLE_FACTORS           	HeLa	Hela cc2-2	Sample source:HeLa | Genotype:control	RAW_FILE_NAME=Hela cc2-2.d
SUBJECT_SAMPLE_FACTORS           	HeLa	Hela cc3-1	Sample source:HeLa | Genotype:control	RAW_FILE_NAME=Hela cc3-1.d
SUBJECT_SAMPLE_FACTORS           	HeLa	Hela cc3-2	Sample source:HeLa | Genotype:control	RAW_FILE_NAME=Hela cc3-2.d
SUBJECT_SAMPLE_FACTORS           	SH-SY5Y	SHSY5Y c32-1	Sample source:SH-SY5Y | Genotype:SIRT6 KO	RAW_FILE_NAME=SHSY5Y c32-1.d
SUBJECT_SAMPLE_FACTORS           	SH-SY5Y	SHSY5Y c32-2	Sample source:SH-SY5Y | Genotype:SIRT6 KO	RAW_FILE_NAME=SHSY5Y c32-2.d
SUBJECT_SAMPLE_FACTORS           	SH-SY5Y	SHSY5Y c33-1	Sample source:SH-SY5Y | Genotype:SIRT6 KO	RAW_FILE_NAME=SHSY5Y c33-1.d
SUBJECT_SAMPLE_FACTORS           	SH-SY5Y	SHSY5Y c33-2	Sample source:SH-SY5Y | Genotype:SIRT6 KO	RAW_FILE_NAME=SHSY5Y c33-2.d
SUBJECT_SAMPLE_FACTORS           	SH-SY5Y	SHSY5Y cc2-1	Sample source:SH-SY5Y | Genotype:control	RAW_FILE_NAME=SHSY5Y cc2-1.d
SUBJECT_SAMPLE_FACTORS           	SH-SY5Y	SHSY5Y cc2-2	Sample source:SH-SY5Y | Genotype:control	RAW_FILE_NAME=SHSY5Y cc2-2.d
SUBJECT_SAMPLE_FACTORS           	SH-SY5Y	SHSY5Y cc3-1	Sample source:SH-SY5Y | Genotype:control	RAW_FILE_NAME=SHSY5Y cc3-1.d
SUBJECT_SAMPLE_FACTORS           	SH-SY5Y	SHSY5Y cc3-2	Sample source:SH-SY5Y | Genotype:control	RAW_FILE_NAME=SHSY5Y cc3-2.d
SUBJECT_SAMPLE_FACTORS           	Mock	Mock01	Sample source:Mock | Genotype:NA	RAW_FILE_NAME=Mock01.d
SUBJECT_SAMPLE_FACTORS           	Mock	Mock02	Sample source:Mock | Genotype:NA	RAW_FILE_NAME=Mock02.d
#COLLECTION
CO:COLLECTION_SUMMARY            	Cell lines (SH-SY5Y, HeLa, ARPE-19) were cultured in Dulbecco’s Minimal
CO:COLLECTION_SUMMARY            	Essential Medium (DMEM with 4.5g/L glucose) or DMEM/F-12 (only ARPE-19 cell
CO:COLLECTION_SUMMARY            	line), in an atmosphere with 5% CO2 at 37°C. Media were supplemented with 10%
CO:COLLECTION_SUMMARY            	fetal bovine serum (FBS), 1% penicillin and streptomycin cocktail, and 1%
CO:COLLECTION_SUMMARY            	L-glutamine.
CO:SAMPLE_TYPE                   	Cultured cells
#TREATMENT
TR:TREATMENT_SUMMARY             	SH-SY5Y, HeLa, and ARPE-19 SIRT6 KO cells were generated as described previously
TR:TREATMENT_SUMMARY             	in Kaluski et al. 2017 (doi: 10.1016/j.celrep.2017.03.008). Briefly, cells were
TR:TREATMENT_SUMMARY             	infected with the lentivirus GeCKO system. We used 2 sgRNA molecules, targeting
TR:TREATMENT_SUMMARY             	Sirt6 CRISPR2 (GCTGTCGCCGTACGCGGACA) and CRISPR3 (GCTCCACGGGAACATGTTTG), and
TR:TREATMENT_SUMMARY             	scrambled gRNA as a control. Constructions were kindly donated by the Prof.
TR:TREATMENT_SUMMARY             	Aharoni lab (Ben-Gurion University, Israel). Cells were selected by means of 2
TR:TREATMENT_SUMMARY             	μg/mL puromycin for a week, followed by serial dilutions to a single cell
TR:TREATMENT_SUMMARY             	colony.
#SAMPLEPREP
SP:SAMPLEPREP_SUMMARY            	Cell lines (SH-SY5Y, HeLa, ARPE-19) metabolite extraction was performed in a
SP:SAMPLEPREP_SUMMARY            	mixture of ice/dry ice, by a cold two-phase methanol–water–chloroform
SP:SAMPLEPREP_SUMMARY            	solution. The samples were resuspended in 800 μl of precooled methanol/water
SP:SAMPLEPREP_SUMMARY            	(5:3 v/v). Afterwards, 500 μl of precooled chloroform was added to each sample.
SP:SAMPLEPREP_SUMMARY            	Samples were vortexed for 10 min at 4 °C and then centrifuged (max. speed, 10
SP:SAMPLEPREP_SUMMARY            	min, 4 °C). The methanol–water phase containing polar metabolites was
SP:SAMPLEPREP_SUMMARY            	separated and dried using a vacuum concentrator at 4 °C overnight, and then
SP:SAMPLEPREP_SUMMARY            	stored at -80 °C until sample preparation for LC-MS analysis. Polar metabolite
SP:SAMPLEPREP_SUMMARY            	extracts previously stored at -80 °C were resuspended in 50 µL of water prior
SP:SAMPLEPREP_SUMMARY            	to LC-MS analysis.
SP:PROCESSING_STORAGE_CONDITIONS 	Described in summary
SP:EXTRACT_STORAGE               	Described in summary
#CHROMATOGRAPHY
CH:CHROMATOGRAPHY_SUMMARY        	For the detection of tryptophan derivatives by LC–MS, we used an Infinity II
CH:CHROMATOGRAPHY_SUMMARY        	1290 liquid chromatography system (Agilent Technologies) with a thermal
CH:CHROMATOGRAPHY_SUMMARY        	autosampler set at 4°C. Samples were resuspended in 50 µL of water, and 20 µL
CH:CHROMATOGRAPHY_SUMMARY        	of each sample were injected onto a C18 column (Acquity UPLC Premier HSS C18 1.8
CH:CHROMATOGRAPHY_SUMMARY        	μm 2.1 × 100 mm). Metabolite separation was achieved with a flow rate of 0.25
CH:CHROMATOGRAPHY_SUMMARY        	ml/min at 30°C, and based on the following 40-minute gradient (solvent A = H2O,
CH:CHROMATOGRAPHY_SUMMARY        	0.1% Formic acid, 15 mM acetic acid; solvent B = Acetonitrile + 0.1% Formic
CH:CHROMATOGRAPHY_SUMMARY        	acid): 0 min 8% B; 2 min 8% B; 14 min 90% B; 16 min 90% B; 17 min 8% B; 22 min
CH:CHROMATOGRAPHY_SUMMARY        	8% B.
CH:CHROMATOGRAPHY_TYPE           	Reversed phase
CH:INSTRUMENT_NAME               	Agilent 1290 Infinity II
CH:COLUMN_NAME                   	Waters ACQUITY UPLC HSS T3 (100 x 2.1 mm, 1.8 μm)
CH:SOLVENT_A                     	100% water; 0.1% formic acid; 15 mM acetic acid
CH:SOLVENT_B                     	100% acetonitrile; 0.1% formic acid
CH:FLOW_GRADIENT                 	0 min 8% B; 2 min 8% B; 14 min 90% B; 16 min 90% B; 17 min 8% B; 22 min 8% B
CH:FLOW_RATE                     	0.25 mL/min
CH:COLUMN_TEMPERATURE            	30°C
#ANALYSIS
AN:ANALYSIS_TYPE                 	MS
#MS
MS:INSTRUMENT_NAME               	Agilent 6546 QTOF
MS:INSTRUMENT_TYPE               	QTOF
MS:MS_TYPE                       	ESI
MS:ION_MODE                      	POSITIVE
MS:MS_COMMENTS                   	Tryptophan derivatives were detected using a Q-TOF 6546 mass spectrometer
MS:MS_COMMENTS                   	(Agilent Technologies) in positive ESI mode. LC-MS data peak identification and
MS:MS_COMMENTS                   	integration were performed with the MassHunter Qualitative and Profinder
MS:MS_COMMENTS                   	softwares (Agilent Technologies, version 10.0 in both cases), respectively.
MS:MS_COMMENTS                   	Integrated data were then analyzed using a home-made MATLAB (R2023b) script.
#MS_METABOLITE_DATA
MS_METABOLITE_DATA:UNITS	Peak Area
MS_METABOLITE_DATA_START
Samples	ARPE19 CC2-1	ARPE19 CC2-2	ARPE19 CC3-1	ARPE19 CC3-2	ARPE19 C32-1	ARPE19 C32-2	ARPE19 C33-1	ARPE19 C33-2	Hela cc2-1	Hela cc2-2	Hela cc3-1	Hela cc3-2	Hela c32-1	Hela c32-2	Hela c33-1	Hela c33-2	SHSY5Y cc2-2	SHSY5Y cc2-1	SHSY5Y cc3-1	SHSY5Y cc3-2	SHSY5Y c32-1	SHSY5Y c32-2	SHSY5Y c33-1	SHSY5Y c33-2
Factors	Sample source:ARPE-19 | Genotype:control	Sample source:ARPE-19 | Genotype:control	Sample source:ARPE-19 | Genotype:control	Sample source:ARPE-19 | Genotype:control	Sample source:ARPE-19 | Genotype:SIRT6 KO	Sample source:ARPE-19 | Genotype:SIRT6 KO	Sample source:ARPE-19 | Genotype:SIRT6 KO	Sample source:ARPE-19 | Genotype:SIRT6 KO	Sample source:HeLa | Genotype:control	Sample source:HeLa | Genotype:control	Sample source:HeLa | Genotype:control	Sample source:HeLa | Genotype:control	Sample source:HeLa | Genotype:SIRT6 KO	Sample source:HeLa | Genotype:SIRT6 KO	Sample source:HeLa | Genotype:SIRT6 KO	Sample source:HeLa | Genotype:SIRT6 KO	Sample source:SH-SY5Y | Genotype:control	Sample source:SH-SY5Y | Genotype:control	Sample source:SH-SY5Y | Genotype:control	Sample source:SH-SY5Y | Genotype:control	Sample source:SH-SY5Y | Genotype:SIRT6 KO	Sample source:SH-SY5Y | Genotype:SIRT6 KO	Sample source:SH-SY5Y | Genotype:SIRT6 KO	Sample source:SH-SY5Y | Genotype:SIRT6 KO
Kynurenic acid	33346	35679	24571	42370	34168	49147	51092	43221	53148	48085	63691	80423	41528	68447	53969	50573	95787	49570	112149	90034	61382	54061	41905	56386
Kynurenine	1498134	1679290	2532763	2968219	2023674	2198194	2368570	2657340	4646149	4831828	6095667	5428556	6358332	5555580	4925160	5513991	3940295	3491947	3463408	3804197	3992631	5119045	4185727	4619075
Anthranilic acid	94562	59497	114800	148083	106954	148094	88353	155314	189247	204715	255895	270659	374542	259963	324143	310824	226113	188549	165876	198381	299556	398861	345272	313705
Serotonin	924021	620530	913459	1171497	698774	750938	792741	720119	3053513	3337580	3947596	3602851	3316013	3232196	2900939	2840318	2697121	2396387	1813080	1901530	1926690	2397436	1727740	1799810
Tryptophan	291669178	262923851	331342495	348230752	296994095	309904258	315591000	315758101	391421628	414951017	423881350	417737718	458233578	448209576	444372165	430527778	339273873	323952123	309096667	310901895	387609928	417680142	378093279	384166625
MS_METABOLITE_DATA_END
#METABOLITES
METABOLITES_START
metabolite_name	PubChem CID	Retention Time (min)
Kynurenic acid	3845	6.9
Kynurenine	161166	3.6
Anthranilic acid	227	8.6
Serotonin	5202	2.9
Tryptophan	6305	6.5
METABOLITES_END
#END